尊敬的 微信汇率:1円 ≈ 0.046166 元 支付宝汇率:1円 ≈ 0.046257元 [退出登录]
SlideShare a Scribd company logo
BecA-ILRI
                                     Bioinformatics Platform
   What is Bioinformatics?

   Bioinformatics is a rapidly developing branch of Information Technology that seeks to exploit the wealth of genome and
   expressed sequence tag (EST) data that has been generated in the last decade. Bioinformatics offers tremendous opportunities
   and has great potential to underpin biotechnological solutions to agricultural development constraints.

   In short, bioinformatics is the key to understanding the molecule of life, DNA

   DNA - Information flow in the molecule of life

                                                         AT GATTAT G G A CA CTTCTTT G
                                                         AAAAATAAT GAT G G A G CTTTA
                                                         G AA G CT GATAACAAAAATTAT
                                                         CAA GATTATAAA G CT G A G C CT
                                                  Gene   G ATAAAACAA G C G AT GTATTA
                                                         G AT GTTACTAAATATAATTCA
                                                         GT G GTA G ATT GTT G C CATAAA
                                                         AATTATTCAACATTTACATCT
                                                         G AAT G GTATATTAAT GAAA G A
                                                         AAATATAAT GAT GTTC CA G AA
                                                         G G A C CAAAAAAT GATTAT G G
                                                         ACA CTTCTTT GAAAAATAAT G
                                                         AT G G A G CTTTA GAA G CT GAT
                                                         AACAAAAATTATCAA G ATT
           Cell        Chromosome       DNA              DNA sequence                           Protein           Livestock, crops, microorganisms

              Impact of Bioinformatics                                                           BecA-ILRI Bioinformatics Platform
                                                                                                   for eastern and central Africa
Bioinformatics is the application of information technology and
computer science to the field of molecular biology. Its primary
                                                                                         The BecA-ILRI Bioinformatics Platform provides
application has been in genomics involving large-scale DNA
sequencing. Some areas that have been significantly
                                                                                         advanced computational capabilities in bioinformatics to
influenced include:                                                                      all BecA-ILRI scientists and provide training in all aspects
                                                                                         of bioinformatics.
    Crop improvement
    •Nutritional enhancement                                                             The platform provides:
    •Insect pest resistance                                                               access to major sequence databases (USA, EU, etc…)
    •Molecular breeding                                                                   access to specialized hardware and sophisticated
    •Drought tolerance                                                                   commercial and academic software
                                                                                          sophisticated data analysis capabilities
                    Vaccine and diagnostics                                               access to High performance computing services and
                     Livestock diseases                                                  grids (CGIAR, EU, USA, etc …)
                     Human diseases

    Microbial biotechnology                                                                                              Research Institutes
    Design microorganisms for:                                                                                              Universities
     Cleaning up waste
     Alternative energy

                                                                                         European Molecular Biology Network                Web interface
                                                                                         EMBRACE Network of Excellence
Current Projects using Bioinformatics platform                                           e-Infrastructure (EELA, GEANT, EGEE)
                                                                                                                                           Direct access

                                                                                         Advanced Research Institutes (EU, USA)                 Broadband
                                                                                                                                                  Internet
Crop improvement                                                                                           Broadband
 Biotechnology applications to combat Cassava Brown Streak                                                   Internet
Disease
 Development of genetic fingerprints for groundnut and pigeon
pea
 Fine mapping of Striga resistance in sorghum
 Marker assisted breeding for drought resistance in sorghum

Vaccines and diagnostics                                                                                                 Direct access
 Integrated response system for emerging infectious diseases in                                                          Web services
East Africa
 East Coast fever recombinant vaccine development                                                                          Broadband
 Contagious bovine pleuropneumonia (CBPP) diagnostic and                                                                     Internet
vaccine development                                                                       CGIAR – HPC Grid
 Development of new diagnostic assays and epidemiological                                 ILRI – Kenya (64 CPUs)                              BecA-ILRI
surveillance of viral pathogens of livestock in Africa                                    IRRI – Philippines (16 CPUs)                      Bioinformatics
 Bioinformatics capacity building                                                         ICRISAT – India (8CPUs)                              platform
                                                                                          CIP – Peru (8 CPUs)




                                                                                                                                           ILRI
                                                                                                                               INTERNATIONAL LIVESTOCK RESEARCH INSTITUTE

More Related Content

What's hot

Session 5: Decision making for eradication and quarantine zones
Session 5: Decision making for eradication and quarantine zonesSession 5: Decision making for eradication and quarantine zones
Session 5: Decision making for eradication and quarantine zones
Plant Biosecurity Cooperative Research Centre
 
ImmunoCellular Company presentation
ImmunoCellular Company presentationImmunoCellular Company presentation
ImmunoCellular Company presentation
guest11f678
 
Session 2: Genome-Informed Diagnostics - In-field Detection of Bacterial Plan...
Session 2: Genome-Informed Diagnostics - In-field Detection of Bacterial Plan...Session 2: Genome-Informed Diagnostics - In-field Detection of Bacterial Plan...
Session 2: Genome-Informed Diagnostics - In-field Detection of Bacterial Plan...
Plant Biosecurity Cooperative Research Centre
 
Virus and viroid testing of solanaceous and cucurbit seed shipments to Australia
Virus and viroid testing of solanaceous and cucurbit seed shipments to AustraliaVirus and viroid testing of solanaceous and cucurbit seed shipments to Australia
Virus and viroid testing of solanaceous and cucurbit seed shipments to Australia
Plant Biosecurity Cooperative Research Centre
 
Session 2: Next generation national fruit fly diagnostics and handbook
Session 2: Next generation national fruit fly diagnostics and handbookSession 2: Next generation national fruit fly diagnostics and handbook
Session 2: Next generation national fruit fly diagnostics and handbook
Plant Biosecurity Cooperative Research Centre
 
Next generation national fruit fly diagnostics and handbook
Next generation national fruit fly diagnostics and handbookNext generation national fruit fly diagnostics and handbook
Next generation national fruit fly diagnostics and handbook
Plant Biosecurity Cooperative Research Centre
 

What's hot (6)

Session 5: Decision making for eradication and quarantine zones
Session 5: Decision making for eradication and quarantine zonesSession 5: Decision making for eradication and quarantine zones
Session 5: Decision making for eradication and quarantine zones
 
ImmunoCellular Company presentation
ImmunoCellular Company presentationImmunoCellular Company presentation
ImmunoCellular Company presentation
 
Session 2: Genome-Informed Diagnostics - In-field Detection of Bacterial Plan...
Session 2: Genome-Informed Diagnostics - In-field Detection of Bacterial Plan...Session 2: Genome-Informed Diagnostics - In-field Detection of Bacterial Plan...
Session 2: Genome-Informed Diagnostics - In-field Detection of Bacterial Plan...
 
Virus and viroid testing of solanaceous and cucurbit seed shipments to Australia
Virus and viroid testing of solanaceous and cucurbit seed shipments to AustraliaVirus and viroid testing of solanaceous and cucurbit seed shipments to Australia
Virus and viroid testing of solanaceous and cucurbit seed shipments to Australia
 
Session 2: Next generation national fruit fly diagnostics and handbook
Session 2: Next generation national fruit fly diagnostics and handbookSession 2: Next generation national fruit fly diagnostics and handbook
Session 2: Next generation national fruit fly diagnostics and handbook
 
Next generation national fruit fly diagnostics and handbook
Next generation national fruit fly diagnostics and handbookNext generation national fruit fly diagnostics and handbook
Next generation national fruit fly diagnostics and handbook
 

Similar to BeCA-ILRI Bioinformatics Platform

BecA Hub/ILRI Bioinformatics Platform
BecA Hub/ILRI Bioinformatics PlatformBecA Hub/ILRI Bioinformatics Platform
BecA Hub/ILRI Bioinformatics Platform
ILRI
 
Animal Repellent System for Smart Farming Using AI and Deep Learning
Animal Repellent System for Smart Farming Using AI and Deep LearningAnimal Repellent System for Smart Farming Using AI and Deep Learning
Animal Repellent System for Smart Farming Using AI and Deep Learning
IRJET Journal
 
Modern biotechnology Dr Nataporn Chanvarasuth
Modern biotechnology  Dr Nataporn ChanvarasuthModern biotechnology  Dr Nataporn Chanvarasuth
Modern biotechnology Dr Nataporn Chanvarasuth
costi2014
 
20121120 sf-india
20121120 sf-india20121120 sf-india
20121120 sf-india
Pisuth paiboonrat
 
BecA-ILRI Hub genomics and bioinformatics platforms
BecA-ILRI Hub genomics and bioinformatics platformsBecA-ILRI Hub genomics and bioinformatics platforms
BecA-ILRI Hub genomics and bioinformatics platforms
ILRI
 
Bioinformatics, its application main
Bioinformatics, its application mainBioinformatics, its application main
Bioinformatics, its application main
KAUSHAL SAHU
 
Bioinformatica 29-09-2011-t1-bioinformatics
Bioinformatica 29-09-2011-t1-bioinformaticsBioinformatica 29-09-2011-t1-bioinformatics
Bioinformatica 29-09-2011-t1-bioinformatics
Prof. Wim Van Criekinge
 
Dr. Nanyingi Technology Keynote
Dr. Nanyingi Technology KeynoteDr. Nanyingi Technology Keynote
Dr. Nanyingi Technology Keynote
Nanyingi Mark
 
Bioinformatics Core at AGERI Present and Future
Bioinformatics Core at AGERI Present and FutureBioinformatics Core at AGERI Present and Future
Bioinformatics Core at AGERI Present and Future
RABNENA Network
 
Cebit Brochure01 31oct08
Cebit Brochure01 31oct08Cebit Brochure01 31oct08
Cebit Brochure01 31oct08
martindudziak
 
Artificial Intelligence In Agriculture: Crop Disease Detection And Monitoring...
Artificial Intelligence In Agriculture: Crop Disease Detection And Monitoring...Artificial Intelligence In Agriculture: Crop Disease Detection And Monitoring...
Artificial Intelligence In Agriculture: Crop Disease Detection And Monitoring...
IRJET Journal
 
Bioinformatics platform: Harnessing bioinformatics for food security and sust...
Bioinformatics platform: Harnessing bioinformatics for food security and sust...Bioinformatics platform: Harnessing bioinformatics for food security and sust...
Bioinformatics platform: Harnessing bioinformatics for food security and sust...
ILRI
 
AI to track plant diseases_S.Srinivasnaik.pdf
AI to track plant diseases_S.Srinivasnaik.pdfAI to track plant diseases_S.Srinivasnaik.pdf
AI to track plant diseases_S.Srinivasnaik.pdf
Asst Prof SSNAIK ENTO PJTSAU
 
Applied Biosystems: Products, Technologies, Future Innovations, Impact on Gen...
Applied Biosystems: Products, Technologies, Future Innovations, Impact on Gen...Applied Biosystems: Products, Technologies, Future Innovations, Impact on Gen...
Applied Biosystems: Products, Technologies, Future Innovations, Impact on Gen...
The Lifesciences Magazine
 
RICE LEAF DISEASES CLASSIFICATION USING CNN WITH TRANSFER LEARNING
RICE LEAF DISEASES CLASSIFICATION USING CNN WITH TRANSFER LEARNINGRICE LEAF DISEASES CLASSIFICATION USING CNN WITH TRANSFER LEARNING
RICE LEAF DISEASES CLASSIFICATION USING CNN WITH TRANSFER LEARNING
IRJET Journal
 
IRJET - Research on Traceability of Agricultural Product based Mostly on Net ...
IRJET - Research on Traceability of Agricultural Product based Mostly on Net ...IRJET - Research on Traceability of Agricultural Product based Mostly on Net ...
IRJET - Research on Traceability of Agricultural Product based Mostly on Net ...
IRJET Journal
 
Genome sequencing in food and agriculture
Genome sequencing in food and agricultureGenome sequencing in food and agriculture
Genome sequencing in food and agriculture
FAO
 
Compute for Cancer - Isaiah Blackburn
Compute for Cancer - Isaiah BlackburnCompute for Cancer - Isaiah Blackburn
Compute for Cancer - Isaiah Blackburn
US-Ignite
 
Applications of information technology in agriculture ws ns for environmental...
Applications of information technology in agriculture ws ns for environmental...Applications of information technology in agriculture ws ns for environmental...
Applications of information technology in agriculture ws ns for environmental...
Aboul Ella Hassanien
 
1. Introduction to Genetic Engineering.pptx
1. Introduction to Genetic Engineering.pptx1. Introduction to Genetic Engineering.pptx
1. Introduction to Genetic Engineering.pptx
samuelmerga3
 

Similar to BeCA-ILRI Bioinformatics Platform (20)

BecA Hub/ILRI Bioinformatics Platform
BecA Hub/ILRI Bioinformatics PlatformBecA Hub/ILRI Bioinformatics Platform
BecA Hub/ILRI Bioinformatics Platform
 
Animal Repellent System for Smart Farming Using AI and Deep Learning
Animal Repellent System for Smart Farming Using AI and Deep LearningAnimal Repellent System for Smart Farming Using AI and Deep Learning
Animal Repellent System for Smart Farming Using AI and Deep Learning
 
Modern biotechnology Dr Nataporn Chanvarasuth
Modern biotechnology  Dr Nataporn ChanvarasuthModern biotechnology  Dr Nataporn Chanvarasuth
Modern biotechnology Dr Nataporn Chanvarasuth
 
20121120 sf-india
20121120 sf-india20121120 sf-india
20121120 sf-india
 
BecA-ILRI Hub genomics and bioinformatics platforms
BecA-ILRI Hub genomics and bioinformatics platformsBecA-ILRI Hub genomics and bioinformatics platforms
BecA-ILRI Hub genomics and bioinformatics platforms
 
Bioinformatics, its application main
Bioinformatics, its application mainBioinformatics, its application main
Bioinformatics, its application main
 
Bioinformatica 29-09-2011-t1-bioinformatics
Bioinformatica 29-09-2011-t1-bioinformaticsBioinformatica 29-09-2011-t1-bioinformatics
Bioinformatica 29-09-2011-t1-bioinformatics
 
Dr. Nanyingi Technology Keynote
Dr. Nanyingi Technology KeynoteDr. Nanyingi Technology Keynote
Dr. Nanyingi Technology Keynote
 
Bioinformatics Core at AGERI Present and Future
Bioinformatics Core at AGERI Present and FutureBioinformatics Core at AGERI Present and Future
Bioinformatics Core at AGERI Present and Future
 
Cebit Brochure01 31oct08
Cebit Brochure01 31oct08Cebit Brochure01 31oct08
Cebit Brochure01 31oct08
 
Artificial Intelligence In Agriculture: Crop Disease Detection And Monitoring...
Artificial Intelligence In Agriculture: Crop Disease Detection And Monitoring...Artificial Intelligence In Agriculture: Crop Disease Detection And Monitoring...
Artificial Intelligence In Agriculture: Crop Disease Detection And Monitoring...
 
Bioinformatics platform: Harnessing bioinformatics for food security and sust...
Bioinformatics platform: Harnessing bioinformatics for food security and sust...Bioinformatics platform: Harnessing bioinformatics for food security and sust...
Bioinformatics platform: Harnessing bioinformatics for food security and sust...
 
AI to track plant diseases_S.Srinivasnaik.pdf
AI to track plant diseases_S.Srinivasnaik.pdfAI to track plant diseases_S.Srinivasnaik.pdf
AI to track plant diseases_S.Srinivasnaik.pdf
 
Applied Biosystems: Products, Technologies, Future Innovations, Impact on Gen...
Applied Biosystems: Products, Technologies, Future Innovations, Impact on Gen...Applied Biosystems: Products, Technologies, Future Innovations, Impact on Gen...
Applied Biosystems: Products, Technologies, Future Innovations, Impact on Gen...
 
RICE LEAF DISEASES CLASSIFICATION USING CNN WITH TRANSFER LEARNING
RICE LEAF DISEASES CLASSIFICATION USING CNN WITH TRANSFER LEARNINGRICE LEAF DISEASES CLASSIFICATION USING CNN WITH TRANSFER LEARNING
RICE LEAF DISEASES CLASSIFICATION USING CNN WITH TRANSFER LEARNING
 
IRJET - Research on Traceability of Agricultural Product based Mostly on Net ...
IRJET - Research on Traceability of Agricultural Product based Mostly on Net ...IRJET - Research on Traceability of Agricultural Product based Mostly on Net ...
IRJET - Research on Traceability of Agricultural Product based Mostly on Net ...
 
Genome sequencing in food and agriculture
Genome sequencing in food and agricultureGenome sequencing in food and agriculture
Genome sequencing in food and agriculture
 
Compute for Cancer - Isaiah Blackburn
Compute for Cancer - Isaiah BlackburnCompute for Cancer - Isaiah Blackburn
Compute for Cancer - Isaiah Blackburn
 
Applications of information technology in agriculture ws ns for environmental...
Applications of information technology in agriculture ws ns for environmental...Applications of information technology in agriculture ws ns for environmental...
Applications of information technology in agriculture ws ns for environmental...
 
1. Introduction to Genetic Engineering.pptx
1. Introduction to Genetic Engineering.pptx1. Introduction to Genetic Engineering.pptx
1. Introduction to Genetic Engineering.pptx
 

More from ILRI

How the small-scale low biosecurity sector could be transformed into a more b...
How the small-scale low biosecurity sector could be transformed into a more b...How the small-scale low biosecurity sector could be transformed into a more b...
How the small-scale low biosecurity sector could be transformed into a more b...
ILRI
 
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
ILRI
 
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
ILRI
 
A training, certification and marketing scheme for informal dairy vendors in ...
A training, certification and marketing scheme for informal dairy vendors in ...A training, certification and marketing scheme for informal dairy vendors in ...
A training, certification and marketing scheme for informal dairy vendors in ...
ILRI
 
Milk safety and child nutrition impacts of the MoreMilk training, certificati...
Milk safety and child nutrition impacts of the MoreMilk training, certificati...Milk safety and child nutrition impacts of the MoreMilk training, certificati...
Milk safety and child nutrition impacts of the MoreMilk training, certificati...
ILRI
 
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseases
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseasesPreventing the next pandemic: a 12-slide primer on emerging zoonotic diseases
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseases
ILRI
 
Preventing preventable diseases: a 12-slide primer on foodborne disease
Preventing preventable diseases: a 12-slide primer on foodborne diseasePreventing preventable diseases: a 12-slide primer on foodborne disease
Preventing preventable diseases: a 12-slide primer on foodborne disease
ILRI
 
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistance
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistancePreventing a post-antibiotic era: a 12-slide primer on antimicrobial resistance
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistance
ILRI
 
Food safety research in low- and middle-income countries
Food safety research in low- and middle-income countriesFood safety research in low- and middle-income countries
Food safety research in low- and middle-income countries
ILRI
 
Food safety research LMIC
Food safety research LMICFood safety research LMIC
Food safety research LMIC
ILRI
 
The application of One Health: Observations from eastern and southern Africa
The application of One Health: Observations from eastern and southern AfricaThe application of One Health: Observations from eastern and southern Africa
The application of One Health: Observations from eastern and southern Africa
ILRI
 
One Health in action: Perspectives from 10 years in the field
One Health in action: Perspectives from 10 years in the fieldOne Health in action: Perspectives from 10 years in the field
One Health in action: Perspectives from 10 years in the field
ILRI
 
Reservoirs of pathogenic Leptospira species in Uganda
Reservoirs of pathogenic Leptospira species in UgandaReservoirs of pathogenic Leptospira species in Uganda
Reservoirs of pathogenic Leptospira species in Uganda
ILRI
 
Minyoo ya mbwa
Minyoo ya mbwaMinyoo ya mbwa
Minyoo ya mbwa
ILRI
 
Parasites in dogs
Parasites in dogsParasites in dogs
Parasites in dogs
ILRI
 
Assessing meat microbiological safety and associated handling practices in bu...
Assessing meat microbiological safety and associated handling practices in bu...Assessing meat microbiological safety and associated handling practices in bu...
Assessing meat microbiological safety and associated handling practices in bu...
ILRI
 
Ecological factors associated with abundance and distribution of mosquito vec...
Ecological factors associated with abundance and distribution of mosquito vec...Ecological factors associated with abundance and distribution of mosquito vec...
Ecological factors associated with abundance and distribution of mosquito vec...
ILRI
 
Livestock in the agrifood systems transformation
Livestock in the agrifood systems transformationLivestock in the agrifood systems transformation
Livestock in the agrifood systems transformation
ILRI
 
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...Development of a fluorescent RBL reporter system for diagnosis of porcine cys...
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...
ILRI
 
Practices and drivers of antibiotic use in Kenyan smallholder dairy farms
Practices and drivers of antibiotic use in Kenyan smallholder dairy farmsPractices and drivers of antibiotic use in Kenyan smallholder dairy farms
Practices and drivers of antibiotic use in Kenyan smallholder dairy farms
ILRI
 

More from ILRI (20)

How the small-scale low biosecurity sector could be transformed into a more b...
How the small-scale low biosecurity sector could be transformed into a more b...How the small-scale low biosecurity sector could be transformed into a more b...
How the small-scale low biosecurity sector could be transformed into a more b...
 
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
 
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
 
A training, certification and marketing scheme for informal dairy vendors in ...
A training, certification and marketing scheme for informal dairy vendors in ...A training, certification and marketing scheme for informal dairy vendors in ...
A training, certification and marketing scheme for informal dairy vendors in ...
 
Milk safety and child nutrition impacts of the MoreMilk training, certificati...
Milk safety and child nutrition impacts of the MoreMilk training, certificati...Milk safety and child nutrition impacts of the MoreMilk training, certificati...
Milk safety and child nutrition impacts of the MoreMilk training, certificati...
 
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseases
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseasesPreventing the next pandemic: a 12-slide primer on emerging zoonotic diseases
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseases
 
Preventing preventable diseases: a 12-slide primer on foodborne disease
Preventing preventable diseases: a 12-slide primer on foodborne diseasePreventing preventable diseases: a 12-slide primer on foodborne disease
Preventing preventable diseases: a 12-slide primer on foodborne disease
 
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistance
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistancePreventing a post-antibiotic era: a 12-slide primer on antimicrobial resistance
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistance
 
Food safety research in low- and middle-income countries
Food safety research in low- and middle-income countriesFood safety research in low- and middle-income countries
Food safety research in low- and middle-income countries
 
Food safety research LMIC
Food safety research LMICFood safety research LMIC
Food safety research LMIC
 
The application of One Health: Observations from eastern and southern Africa
The application of One Health: Observations from eastern and southern AfricaThe application of One Health: Observations from eastern and southern Africa
The application of One Health: Observations from eastern and southern Africa
 
One Health in action: Perspectives from 10 years in the field
One Health in action: Perspectives from 10 years in the fieldOne Health in action: Perspectives from 10 years in the field
One Health in action: Perspectives from 10 years in the field
 
Reservoirs of pathogenic Leptospira species in Uganda
Reservoirs of pathogenic Leptospira species in UgandaReservoirs of pathogenic Leptospira species in Uganda
Reservoirs of pathogenic Leptospira species in Uganda
 
Minyoo ya mbwa
Minyoo ya mbwaMinyoo ya mbwa
Minyoo ya mbwa
 
Parasites in dogs
Parasites in dogsParasites in dogs
Parasites in dogs
 
Assessing meat microbiological safety and associated handling practices in bu...
Assessing meat microbiological safety and associated handling practices in bu...Assessing meat microbiological safety and associated handling practices in bu...
Assessing meat microbiological safety and associated handling practices in bu...
 
Ecological factors associated with abundance and distribution of mosquito vec...
Ecological factors associated with abundance and distribution of mosquito vec...Ecological factors associated with abundance and distribution of mosquito vec...
Ecological factors associated with abundance and distribution of mosquito vec...
 
Livestock in the agrifood systems transformation
Livestock in the agrifood systems transformationLivestock in the agrifood systems transformation
Livestock in the agrifood systems transformation
 
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...Development of a fluorescent RBL reporter system for diagnosis of porcine cys...
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...
 
Practices and drivers of antibiotic use in Kenyan smallholder dairy farms
Practices and drivers of antibiotic use in Kenyan smallholder dairy farmsPractices and drivers of antibiotic use in Kenyan smallholder dairy farms
Practices and drivers of antibiotic use in Kenyan smallholder dairy farms
 

Recently uploaded

QA or the Highway - Component Testing: Bridging the gap between frontend appl...
QA or the Highway - Component Testing: Bridging the gap between frontend appl...QA or the Highway - Component Testing: Bridging the gap between frontend appl...
QA or the Highway - Component Testing: Bridging the gap between frontend appl...
zjhamm304
 
Lee Barnes - Path to Becoming an Effective Test Automation Engineer.pdf
Lee Barnes - Path to Becoming an Effective Test Automation Engineer.pdfLee Barnes - Path to Becoming an Effective Test Automation Engineer.pdf
Lee Barnes - Path to Becoming an Effective Test Automation Engineer.pdf
leebarnesutopia
 
Building a Semantic Layer of your Data Platform
Building a Semantic Layer of your Data PlatformBuilding a Semantic Layer of your Data Platform
Building a Semantic Layer of your Data Platform
Enterprise Knowledge
 
QR Secure: A Hybrid Approach Using Machine Learning and Security Validation F...
QR Secure: A Hybrid Approach Using Machine Learning and Security Validation F...QR Secure: A Hybrid Approach Using Machine Learning and Security Validation F...
QR Secure: A Hybrid Approach Using Machine Learning and Security Validation F...
AlexanderRichford
 
Demystifying Knowledge Management through Storytelling
Demystifying Knowledge Management through StorytellingDemystifying Knowledge Management through Storytelling
Demystifying Knowledge Management through Storytelling
Enterprise Knowledge
 
Multivendor cloud production with VSF TR-11 - there and back again
Multivendor cloud production with VSF TR-11 - there and back againMultivendor cloud production with VSF TR-11 - there and back again
Multivendor cloud production with VSF TR-11 - there and back again
Kieran Kunhya
 
Communications Mining Series - Zero to Hero - Session 2
Communications Mining Series - Zero to Hero - Session 2Communications Mining Series - Zero to Hero - Session 2
Communications Mining Series - Zero to Hero - Session 2
DianaGray10
 
Call Girls Chandigarh🔥7023059433🔥Agency Profile Escorts in Chandigarh Availab...
Call Girls Chandigarh🔥7023059433🔥Agency Profile Escorts in Chandigarh Availab...Call Girls Chandigarh🔥7023059433🔥Agency Profile Escorts in Chandigarh Availab...
Call Girls Chandigarh🔥7023059433🔥Agency Profile Escorts in Chandigarh Availab...
manji sharman06
 
CNSCon 2024 Lightning Talk: Don’t Make Me Impersonate My Identity
CNSCon 2024 Lightning Talk: Don’t Make Me Impersonate My IdentityCNSCon 2024 Lightning Talk: Don’t Make Me Impersonate My Identity
CNSCon 2024 Lightning Talk: Don’t Make Me Impersonate My Identity
Cynthia Thomas
 
Call Girls Chennai ☎️ +91-7426014248 😍 Chennai Call Girl Beauty Girls Chennai...
Call Girls Chennai ☎️ +91-7426014248 😍 Chennai Call Girl Beauty Girls Chennai...Call Girls Chennai ☎️ +91-7426014248 😍 Chennai Call Girl Beauty Girls Chennai...
Call Girls Chennai ☎️ +91-7426014248 😍 Chennai Call Girl Beauty Girls Chennai...
anilsa9823
 
Automation Student Developers Session 3: Introduction to UI Automation
Automation Student Developers Session 3: Introduction to UI AutomationAutomation Student Developers Session 3: Introduction to UI Automation
Automation Student Developers Session 3: Introduction to UI Automation
UiPathCommunity
 
Northern Engraving | Modern Metal Trim, Nameplates and Appliance Panels
Northern Engraving | Modern Metal Trim, Nameplates and Appliance PanelsNorthern Engraving | Modern Metal Trim, Nameplates and Appliance Panels
Northern Engraving | Modern Metal Trim, Nameplates and Appliance Panels
Northern Engraving
 
DynamoDB to ScyllaDB: Technical Comparison and the Path to Success
DynamoDB to ScyllaDB: Technical Comparison and the Path to SuccessDynamoDB to ScyllaDB: Technical Comparison and the Path to Success
DynamoDB to ScyllaDB: Technical Comparison and the Path to Success
ScyllaDB
 
APJC Introduction to ThousandEyes Webinar
APJC Introduction to ThousandEyes WebinarAPJC Introduction to ThousandEyes Webinar
APJC Introduction to ThousandEyes Webinar
ThousandEyes
 
Day 4 - Excel Automation and Data Manipulation
Day 4 - Excel Automation and Data ManipulationDay 4 - Excel Automation and Data Manipulation
Day 4 - Excel Automation and Data Manipulation
UiPathCommunity
 
MongoDB to ScyllaDB: Technical Comparison and the Path to Success
MongoDB to ScyllaDB: Technical Comparison and the Path to SuccessMongoDB to ScyllaDB: Technical Comparison and the Path to Success
MongoDB to ScyllaDB: Technical Comparison and the Path to Success
ScyllaDB
 
TrustArc Webinar - Your Guide for Smooth Cross-Border Data Transfers and Glob...
TrustArc Webinar - Your Guide for Smooth Cross-Border Data Transfers and Glob...TrustArc Webinar - Your Guide for Smooth Cross-Border Data Transfers and Glob...
TrustArc Webinar - Your Guide for Smooth Cross-Border Data Transfers and Glob...
TrustArc
 
Poznań ACE event - 19.06.2024 Team 24 Wrapup slidedeck
Poznań ACE event - 19.06.2024 Team 24 Wrapup slidedeckPoznań ACE event - 19.06.2024 Team 24 Wrapup slidedeck
Poznań ACE event - 19.06.2024 Team 24 Wrapup slidedeck
FilipTomaszewski5
 
An All-Around Benchmark of the DBaaS Market
An All-Around Benchmark of the DBaaS MarketAn All-Around Benchmark of the DBaaS Market
An All-Around Benchmark of the DBaaS Market
ScyllaDB
 
So You've Lost Quorum: Lessons From Accidental Downtime
So You've Lost Quorum: Lessons From Accidental DowntimeSo You've Lost Quorum: Lessons From Accidental Downtime
So You've Lost Quorum: Lessons From Accidental Downtime
ScyllaDB
 

Recently uploaded (20)

QA or the Highway - Component Testing: Bridging the gap between frontend appl...
QA or the Highway - Component Testing: Bridging the gap between frontend appl...QA or the Highway - Component Testing: Bridging the gap between frontend appl...
QA or the Highway - Component Testing: Bridging the gap between frontend appl...
 
Lee Barnes - Path to Becoming an Effective Test Automation Engineer.pdf
Lee Barnes - Path to Becoming an Effective Test Automation Engineer.pdfLee Barnes - Path to Becoming an Effective Test Automation Engineer.pdf
Lee Barnes - Path to Becoming an Effective Test Automation Engineer.pdf
 
Building a Semantic Layer of your Data Platform
Building a Semantic Layer of your Data PlatformBuilding a Semantic Layer of your Data Platform
Building a Semantic Layer of your Data Platform
 
QR Secure: A Hybrid Approach Using Machine Learning and Security Validation F...
QR Secure: A Hybrid Approach Using Machine Learning and Security Validation F...QR Secure: A Hybrid Approach Using Machine Learning and Security Validation F...
QR Secure: A Hybrid Approach Using Machine Learning and Security Validation F...
 
Demystifying Knowledge Management through Storytelling
Demystifying Knowledge Management through StorytellingDemystifying Knowledge Management through Storytelling
Demystifying Knowledge Management through Storytelling
 
Multivendor cloud production with VSF TR-11 - there and back again
Multivendor cloud production with VSF TR-11 - there and back againMultivendor cloud production with VSF TR-11 - there and back again
Multivendor cloud production with VSF TR-11 - there and back again
 
Communications Mining Series - Zero to Hero - Session 2
Communications Mining Series - Zero to Hero - Session 2Communications Mining Series - Zero to Hero - Session 2
Communications Mining Series - Zero to Hero - Session 2
 
Call Girls Chandigarh🔥7023059433🔥Agency Profile Escorts in Chandigarh Availab...
Call Girls Chandigarh🔥7023059433🔥Agency Profile Escorts in Chandigarh Availab...Call Girls Chandigarh🔥7023059433🔥Agency Profile Escorts in Chandigarh Availab...
Call Girls Chandigarh🔥7023059433🔥Agency Profile Escorts in Chandigarh Availab...
 
CNSCon 2024 Lightning Talk: Don’t Make Me Impersonate My Identity
CNSCon 2024 Lightning Talk: Don’t Make Me Impersonate My IdentityCNSCon 2024 Lightning Talk: Don’t Make Me Impersonate My Identity
CNSCon 2024 Lightning Talk: Don’t Make Me Impersonate My Identity
 
Call Girls Chennai ☎️ +91-7426014248 😍 Chennai Call Girl Beauty Girls Chennai...
Call Girls Chennai ☎️ +91-7426014248 😍 Chennai Call Girl Beauty Girls Chennai...Call Girls Chennai ☎️ +91-7426014248 😍 Chennai Call Girl Beauty Girls Chennai...
Call Girls Chennai ☎️ +91-7426014248 😍 Chennai Call Girl Beauty Girls Chennai...
 
Automation Student Developers Session 3: Introduction to UI Automation
Automation Student Developers Session 3: Introduction to UI AutomationAutomation Student Developers Session 3: Introduction to UI Automation
Automation Student Developers Session 3: Introduction to UI Automation
 
Northern Engraving | Modern Metal Trim, Nameplates and Appliance Panels
Northern Engraving | Modern Metal Trim, Nameplates and Appliance PanelsNorthern Engraving | Modern Metal Trim, Nameplates and Appliance Panels
Northern Engraving | Modern Metal Trim, Nameplates and Appliance Panels
 
DynamoDB to ScyllaDB: Technical Comparison and the Path to Success
DynamoDB to ScyllaDB: Technical Comparison and the Path to SuccessDynamoDB to ScyllaDB: Technical Comparison and the Path to Success
DynamoDB to ScyllaDB: Technical Comparison and the Path to Success
 
APJC Introduction to ThousandEyes Webinar
APJC Introduction to ThousandEyes WebinarAPJC Introduction to ThousandEyes Webinar
APJC Introduction to ThousandEyes Webinar
 
Day 4 - Excel Automation and Data Manipulation
Day 4 - Excel Automation and Data ManipulationDay 4 - Excel Automation and Data Manipulation
Day 4 - Excel Automation and Data Manipulation
 
MongoDB to ScyllaDB: Technical Comparison and the Path to Success
MongoDB to ScyllaDB: Technical Comparison and the Path to SuccessMongoDB to ScyllaDB: Technical Comparison and the Path to Success
MongoDB to ScyllaDB: Technical Comparison and the Path to Success
 
TrustArc Webinar - Your Guide for Smooth Cross-Border Data Transfers and Glob...
TrustArc Webinar - Your Guide for Smooth Cross-Border Data Transfers and Glob...TrustArc Webinar - Your Guide for Smooth Cross-Border Data Transfers and Glob...
TrustArc Webinar - Your Guide for Smooth Cross-Border Data Transfers and Glob...
 
Poznań ACE event - 19.06.2024 Team 24 Wrapup slidedeck
Poznań ACE event - 19.06.2024 Team 24 Wrapup slidedeckPoznań ACE event - 19.06.2024 Team 24 Wrapup slidedeck
Poznań ACE event - 19.06.2024 Team 24 Wrapup slidedeck
 
An All-Around Benchmark of the DBaaS Market
An All-Around Benchmark of the DBaaS MarketAn All-Around Benchmark of the DBaaS Market
An All-Around Benchmark of the DBaaS Market
 
So You've Lost Quorum: Lessons From Accidental Downtime
So You've Lost Quorum: Lessons From Accidental DowntimeSo You've Lost Quorum: Lessons From Accidental Downtime
So You've Lost Quorum: Lessons From Accidental Downtime
 

BeCA-ILRI Bioinformatics Platform

  • 1. BecA-ILRI Bioinformatics Platform What is Bioinformatics? Bioinformatics is a rapidly developing branch of Information Technology that seeks to exploit the wealth of genome and expressed sequence tag (EST) data that has been generated in the last decade. Bioinformatics offers tremendous opportunities and has great potential to underpin biotechnological solutions to agricultural development constraints. In short, bioinformatics is the key to understanding the molecule of life, DNA DNA - Information flow in the molecule of life AT GATTAT G G A CA CTTCTTT G AAAAATAAT GAT G G A G CTTTA G AA G CT GATAACAAAAATTAT CAA GATTATAAA G CT G A G C CT Gene G ATAAAACAA G C G AT GTATTA G AT GTTACTAAATATAATTCA GT G GTA G ATT GTT G C CATAAA AATTATTCAACATTTACATCT G AAT G GTATATTAAT GAAA G A AAATATAAT GAT GTTC CA G AA G G A C CAAAAAAT GATTAT G G ACA CTTCTTT GAAAAATAAT G AT G G A G CTTTA GAA G CT GAT AACAAAAATTATCAA G ATT Cell Chromosome DNA DNA sequence Protein Livestock, crops, microorganisms Impact of Bioinformatics BecA-ILRI Bioinformatics Platform for eastern and central Africa Bioinformatics is the application of information technology and computer science to the field of molecular biology. Its primary The BecA-ILRI Bioinformatics Platform provides application has been in genomics involving large-scale DNA sequencing. Some areas that have been significantly advanced computational capabilities in bioinformatics to influenced include: all BecA-ILRI scientists and provide training in all aspects of bioinformatics. Crop improvement •Nutritional enhancement The platform provides: •Insect pest resistance access to major sequence databases (USA, EU, etc…) •Molecular breeding access to specialized hardware and sophisticated •Drought tolerance commercial and academic software sophisticated data analysis capabilities Vaccine and diagnostics access to High performance computing services and Livestock diseases grids (CGIAR, EU, USA, etc …) Human diseases Microbial biotechnology Research Institutes Design microorganisms for: Universities Cleaning up waste Alternative energy European Molecular Biology Network Web interface EMBRACE Network of Excellence Current Projects using Bioinformatics platform e-Infrastructure (EELA, GEANT, EGEE) Direct access Advanced Research Institutes (EU, USA) Broadband Internet Crop improvement Broadband Biotechnology applications to combat Cassava Brown Streak Internet Disease Development of genetic fingerprints for groundnut and pigeon pea Fine mapping of Striga resistance in sorghum Marker assisted breeding for drought resistance in sorghum Vaccines and diagnostics Direct access Integrated response system for emerging infectious diseases in Web services East Africa East Coast fever recombinant vaccine development Broadband Contagious bovine pleuropneumonia (CBPP) diagnostic and Internet vaccine development CGIAR – HPC Grid Development of new diagnostic assays and epidemiological ILRI – Kenya (64 CPUs) BecA-ILRI surveillance of viral pathogens of livestock in Africa IRRI – Philippines (16 CPUs) Bioinformatics Bioinformatics capacity building ICRISAT – India (8CPUs) platform CIP – Peru (8 CPUs) ILRI INTERNATIONAL LIVESTOCK RESEARCH INSTITUTE
  翻译: