尊敬的 微信汇率:1円 ≈ 0.046166 元 支付宝汇率:1円 ≈ 0.046257元 [退出登录]
SlideShare a Scribd company logo
Targeted Breeding
Applications of CRISPR-Cas
Doane Chilcoat, DuPont Pioneer, Dow DuPont
• Why we are excited about genome editing
• Genome editing technology
• Examples
Six vegetables that are the same biological species
Kohlrabi Kale Broccoli Brussels Sprouts Cabbage Cauliflower
Wild mustard
Genome editing replicates naturally occurring outcomes
Duplication of SUN gene
changes fruit morphology
Genome editing replicates naturally occurring outcomes
Between two corn
varieties
• 100s of genes with
different numbers of
copies
• 1,000s of genes
absent in one but
present in the other
Genome editing replicates naturally occurring outcomes
Genome editing replicates naturally occurring outcomes
• 7 single nucleotide
mutations per billion
base pairs per
generation
• 1 hectare of soy has
>1.8 million novel
mutations
Year: 1 2 3 4 5 6 7 8 9 10 11 12 13 14
Editing
Edited variety development can be rapid
Breeding
Transgenes
1st commercial
sales in year 13-20
1st commercial
sales in year 4
1st commercial
sales in year 9
Many potential applications for genome editing
• Why we are excited about genome editing
• Genome editing technology
• Examples
Elite line plant regeneration
Reference genomics
Double strand break
reagents
Technology foundation for plant genome editing
Plant Cell (2005)
Example of maize diversity
Mo17-specific:
30kb
Shared sequence: A B C D E
B73-specific:
F G
H I
New technologies enable reference genomes
Sequel
ContigsLong reads
Saphyr
ScaffoldsOptical mapping
Chromium PolishingRead clouds
Chromosomes
HiC
Technology Application Outcome
Genome contiguity
Pioneer Maize2: a new benchmark for maize reference genomes
17
11 16
11
9
7 5 7
10
1
197
De novo elite maize reference genome
• Contig N50 2.8 Mb
• Scaffold N50 36.9 Mb
Chr01 Chr02 Chr03 Chr04 Chr05 Chr06 Chr07 Chr08 Chr09 Chr10 Unmapped
Elite line plant regeneration
18.7
15.4
9
29
45.5
34.2
20
0.6
4.8 6
2.6
PH2HT PHH5G PH43V PH85E PHAF7 PHCD9 PH4M3 PH84Z PHCMS PH26C PH8SY
Regeneration frequency
Percent
50.0
After
optimization
Vectors containing Babyboom and Wuschel trigger
rapid somatic embryogenesis
Embryos at
7 days
Well
formed
somatic
embryos
visible at 2-
4 days
High
mitotic
index in
young
embryos
15
Site-Seq can identify off-sites
High molecular weight
genomic DNA
Digest with Cas9 RNP
“A” addition
Ligate biotinylated adapter
Random shear / size select
“ A” addition, ligation to adapters
Biotin selection
PCR
Sequencing
20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 PAM
G G C C G A G G T C G A C T A C C G G C CGG M2 MS45-CR2
C G C C G A G G G C G A C T A C C G G C AGG Off-Site 1
G G T G G G G G T C G A C T A C C G G C AGG Off-Site 2
C G A C T A G A T C G A C T A C C G G C GGG Off-Site 3
C G C C G C G G G C G A C T A C C G G C AGG Off-Site 4
G G G A C G A G G C G A T T A C C G G C GGG Off-Site 5
A G A C G A T G T C G A C C G C C G C GGG Off-Site 6
G C C C C A T G T C G A C T A C C G G C AGG Off-Site 7
A T G G C T A G G A G A C T A C C G G C TGG Off-Site 8
Red = Mismatch; Black = Gap
Site-Seq can identify off-sites
1. Select unique sites informatically
Achieving specificity through guide design and testing
1 Mismatch 2 Mismatch 3 Mismatch 4 Mismatch
Site 1 0 0 0 0
Site 2 0 0 0 0
Site 3 0 0 0 23
Site 4 0 0 8 34
Site 5 0 0 10 41
Site 6 0 0 54 261
Site 7 0 1 51 236
Site 8 0 2 151 116
Site 9 0 3 48 126
Site 10 0 7 117 396
Site 11 0 9 96 528
Site 12 0 10 317 2209
Site 13 0 32 674 1142
Site 14 1 19 764 2713
Site 15 3 41 433 635
Number of Predicted Off-Sites
Effect of RNP Concentration on On- and Off-Site Cleavage
20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 PAM 10 nM 100 nM 1000 nM
On-Site G G C C G A G G T C G A C T A C C G G C CGG Y Y Y
Off-Site 1 C G C C G A G G G C G A C T A C C G G C AGG Y Y Y
Off-Site 2 G G T G G G G G T C G A C T A C C G G C AGG Y Y Y
Off-Site 3 C G A C T A G A T C G A C T A C C G G C GGG N Y Y
Off-Site 4 C G C C G C G G G C G A C T A C C G G C AGG N Y Y
Off-Site 5 G G G A C G A G G C G A T T A C C G G C GGG N N Y
Protospacer RNP Concentration
2. Confirm target specificity in vitro (SITE-Seq+)
On/off-target
sequencing
Select off-target
free plant
Backcross to remove potential
off-site mutation
T0 WT 50% T0
50% WT
WT
X
Ensuring edited plants match recurrent parents
25% T0
75% WT
Double strand break reagents
Streptococcus pyogenes Cas9
Guide RNA matches
the target DNA
sequence
Cas9 nuclease
(DNA cutting enzyme)
Target Sequence
Guide RNA
• Why we are excited about genome editing
• Genome editing technology
• Examples
How can we use CRISPR-Cas?
WHEAT
Seed No Seed
Delete
Edit
Move
CRISPR-Cas: DuPont Pioneer work across crops
Today’s presentation
*
Disease Yield Drought Output Maturity
Corn
Soy
Canola
Rice
Wheat
Sunflower
** *
Example #1: Waxy corn
Waxy Corn
• Non-functional wx1
• Candlewax-like appearance
• Food / industrial
>97%
Amylopectin
Starch
• Functional wx1
• Translucent appearance
• Feed / ethanol / food
No. 2 Yellow Dent Corn
75%
Amylopectin
25%
Amylose
Starch
Pioneer’s first commercial product through targeted breeding
Status
• Edits made in multiple inbreds – can be
combined to make 10 elite hybrids
• Contain expected edit; no other DNA
• Expected waxy seed composition
Wild-type Wx1
Transcriptional start
Guide 1 Guide 2
4kb deletion
Edited Wx1
Iodine stain of segregating
seeds
Waxy
kernel
Stains
lighter
Waxy corn gene editing approach: gene deletion
Regulatory/ Acceptance
CRISPR waxy large scale field trials summer 2017
• USDA: not regulated by its Biotechnology Regulatory Service
• CONABIA: not a “GMO” under Argentina law
• Other import markets: discussions underway
Wild type Conventional waxy CRISPR waxy
Example #2: corn northern leaf blight (NLB)
Fungal disease caused by Exserohilum turcicum Grain yield loss can be 18% - 98%
Resistance to northern leaf blight
• NLB18 gene cloned and encodes
a receptor-like kinase
• Transgenic maize plants
overexpressing NLB18 with
heterologous promoter are
resistant to NLB
NLB18 overexpression Wild type
Inserted the resistant NLB18 gene at a
breeding stack locus
NLB gene editing approach
(a): gene insertion
Hemizygous Null Homozygous
1.0
1.8
NLB 18 expression
RT-PCR
2017 field testing
5.4
v
v
v
Chr1
Resistant
allele
Mutants generated using EMS
2016
Example #3: Fea3
Editing Fea3 to generate 3-2 allele
C417Y
GCGGCGGTTCGCGTCGTGGGACAACCCCGGGCTGTGCTACAACGTC
CGCCGCCAAGCGCAGCACCCTGTTGGGGCCCGACACGATGTTGCAG
GCGGCGGTTCGCGTCGTGGGACAACCCCGGTCTGTACTACAACGTC
Cys
Tyr
PAM
GCGGCGGTTCGCGTCGTGGGATAACCCAGGTCTGTACTACAACGTC
Guide 1
Guide 2
Repair template: oligos with 3’ protected ends (phosphorothioate)
Fea3-2
Generated fea3-2 in elite inbreds
Oligo template T0 plants
Plants with
desired edit
dsOligo-1 144 6
dsOligo-2 162 16
CRISPRCas.pioneer.com
Abundant Potential for Agriculture

More Related Content

What's hot

Plant genome sequencing and crop improvement
Plant genome sequencing and crop improvementPlant genome sequencing and crop improvement
Plant genome sequencing and crop improvement
Ragavendran Abbai
 
Molecular markers and Functional molecular markers
Molecular markers and Functional molecular markersMolecular markers and Functional molecular markers
Molecular markers and Functional molecular markers
Chandana B.R.
 
An overview of agricultural applications of genome editing: Crop plants
An overview of agricultural applications of genome editing: Crop plantsAn overview of agricultural applications of genome editing: Crop plants
An overview of agricultural applications of genome editing: Crop plants
OECD Environment
 
RNAi – Mechanism and Its Application In Crop Improvement
RNAi – Mechanism and Its Application In Crop ImprovementRNAi – Mechanism and Its Application In Crop Improvement
RNAi – Mechanism and Its Application In Crop Improvement
kundan Jadhao
 
TALENs: A WIDELY APPLICABLE TECHNOLOGY FOR TARGETED GENOME EDITING
TALENs: A WIDELY APPLICABLE TECHNOLOGY FOR TARGETED GENOME EDITINGTALENs: A WIDELY APPLICABLE TECHNOLOGY FOR TARGETED GENOME EDITING
TALENs: A WIDELY APPLICABLE TECHNOLOGY FOR TARGETED GENOME EDITING
Mahammed Faizan
 
Single Nucleotide Polymorphism Genotyping Using Kompetitive Allele Specific ...
Single Nucleotide Polymorphism Genotyping Using Kompetitive Allele Specific ...Single Nucleotide Polymorphism Genotyping Using Kompetitive Allele Specific ...
Single Nucleotide Polymorphism Genotyping Using Kompetitive Allele Specific ...
MANGLAM ARYA
 
Transgene silencing
Transgene silencingTransgene silencing
Transgene silencing
pooranachithra flowry
 
CRISPR-Cas systems and applications
CRISPR-Cas systems and applicationsCRISPR-Cas systems and applications
CRISPR-Cas systems and applications
M.pooya naghshbandi
 
Genome editing
Genome editingGenome editing
Genome editing
Bhavya Sree
 
Omics in crop improvement
Omics in crop improvementOmics in crop improvement
Omics in crop improvement
Kasanaboina Krishna
 
MAGIC populations and its role in crop improvement
MAGIC populations and its role in crop improvementMAGIC populations and its role in crop improvement
MAGIC populations and its role in crop improvement
Dr. Asit Prasad Dash
 
Research Program Genetic Gains (RPGG) Review Meeting 2021: Forward Breeding: ...
Research Program Genetic Gains (RPGG) Review Meeting 2021: Forward Breeding: ...Research Program Genetic Gains (RPGG) Review Meeting 2021: Forward Breeding: ...
Research Program Genetic Gains (RPGG) Review Meeting 2021: Forward Breeding: ...
ICRISAT
 
Development of climate resilient crops / agriculture
Development of climate resilient crops / agricultureDevelopment of climate resilient crops / agriculture
Development of climate resilient crops / agriculture
Amol Gaikwad
 
Molecular Marker-assisted Breeding in Rice
Molecular Marker-assisted Breeding in RiceMolecular Marker-assisted Breeding in Rice
Molecular Marker-assisted Breeding in Rice
FOODCROPS
 
Reverse Breeding: a tool to create homozygous plants from the heterozygous po...
Reverse Breeding: a tool to create homozygous plants from the heterozygous po...Reverse Breeding: a tool to create homozygous plants from the heterozygous po...
Reverse Breeding: a tool to create homozygous plants from the heterozygous po...
Sanjay Kumar
 
Marker assisted breeding of biotic stress resistance in Rice
Marker assisted breeding of biotic stress resistance in Rice Marker assisted breeding of biotic stress resistance in Rice
Marker assisted breeding of biotic stress resistance in Rice
Senthil Natesan
 
CRISPR, cas9 in plant disease resistance
CRISPR, cas9 in plant disease resistance CRISPR, cas9 in plant disease resistance
CRISPR, cas9 in plant disease resistance
N.H. Shankar Reddy
 
Crispr cas
Crispr casCrispr cas
Microsatellites Markers
Microsatellites  MarkersMicrosatellites  Markers
Microsatellites Markers
Karan Veer Singh
 
Potential for off-target effects in topically applied dsRNA-based products us...
Potential for off-target effects in topically applied dsRNA-based products us...Potential for off-target effects in topically applied dsRNA-based products us...
Potential for off-target effects in topically applied dsRNA-based products us...
OECD Environment
 

What's hot (20)

Plant genome sequencing and crop improvement
Plant genome sequencing and crop improvementPlant genome sequencing and crop improvement
Plant genome sequencing and crop improvement
 
Molecular markers and Functional molecular markers
Molecular markers and Functional molecular markersMolecular markers and Functional molecular markers
Molecular markers and Functional molecular markers
 
An overview of agricultural applications of genome editing: Crop plants
An overview of agricultural applications of genome editing: Crop plantsAn overview of agricultural applications of genome editing: Crop plants
An overview of agricultural applications of genome editing: Crop plants
 
RNAi – Mechanism and Its Application In Crop Improvement
RNAi – Mechanism and Its Application In Crop ImprovementRNAi – Mechanism and Its Application In Crop Improvement
RNAi – Mechanism and Its Application In Crop Improvement
 
TALENs: A WIDELY APPLICABLE TECHNOLOGY FOR TARGETED GENOME EDITING
TALENs: A WIDELY APPLICABLE TECHNOLOGY FOR TARGETED GENOME EDITINGTALENs: A WIDELY APPLICABLE TECHNOLOGY FOR TARGETED GENOME EDITING
TALENs: A WIDELY APPLICABLE TECHNOLOGY FOR TARGETED GENOME EDITING
 
Single Nucleotide Polymorphism Genotyping Using Kompetitive Allele Specific ...
Single Nucleotide Polymorphism Genotyping Using Kompetitive Allele Specific ...Single Nucleotide Polymorphism Genotyping Using Kompetitive Allele Specific ...
Single Nucleotide Polymorphism Genotyping Using Kompetitive Allele Specific ...
 
Transgene silencing
Transgene silencingTransgene silencing
Transgene silencing
 
CRISPR-Cas systems and applications
CRISPR-Cas systems and applicationsCRISPR-Cas systems and applications
CRISPR-Cas systems and applications
 
Genome editing
Genome editingGenome editing
Genome editing
 
Omics in crop improvement
Omics in crop improvementOmics in crop improvement
Omics in crop improvement
 
MAGIC populations and its role in crop improvement
MAGIC populations and its role in crop improvementMAGIC populations and its role in crop improvement
MAGIC populations and its role in crop improvement
 
Research Program Genetic Gains (RPGG) Review Meeting 2021: Forward Breeding: ...
Research Program Genetic Gains (RPGG) Review Meeting 2021: Forward Breeding: ...Research Program Genetic Gains (RPGG) Review Meeting 2021: Forward Breeding: ...
Research Program Genetic Gains (RPGG) Review Meeting 2021: Forward Breeding: ...
 
Development of climate resilient crops / agriculture
Development of climate resilient crops / agricultureDevelopment of climate resilient crops / agriculture
Development of climate resilient crops / agriculture
 
Molecular Marker-assisted Breeding in Rice
Molecular Marker-assisted Breeding in RiceMolecular Marker-assisted Breeding in Rice
Molecular Marker-assisted Breeding in Rice
 
Reverse Breeding: a tool to create homozygous plants from the heterozygous po...
Reverse Breeding: a tool to create homozygous plants from the heterozygous po...Reverse Breeding: a tool to create homozygous plants from the heterozygous po...
Reverse Breeding: a tool to create homozygous plants from the heterozygous po...
 
Marker assisted breeding of biotic stress resistance in Rice
Marker assisted breeding of biotic stress resistance in Rice Marker assisted breeding of biotic stress resistance in Rice
Marker assisted breeding of biotic stress resistance in Rice
 
CRISPR, cas9 in plant disease resistance
CRISPR, cas9 in plant disease resistance CRISPR, cas9 in plant disease resistance
CRISPR, cas9 in plant disease resistance
 
Crispr cas
Crispr casCrispr cas
Crispr cas
 
Microsatellites Markers
Microsatellites  MarkersMicrosatellites  Markers
Microsatellites Markers
 
Potential for off-target effects in topically applied dsRNA-based products us...
Potential for off-target effects in topically applied dsRNA-based products us...Potential for off-target effects in topically applied dsRNA-based products us...
Potential for off-target effects in topically applied dsRNA-based products us...
 

Similar to Targeted Breeding Applications of CRISPR-Cas

CRISPR mediated haploid inducer stock development in rice
CRISPR mediated haploid inducer stock development in riceCRISPR mediated haploid inducer stock development in rice
CRISPR mediated haploid inducer stock development in rice
PUNJAB AGRICULTURAL UNIVERSITY, LUDHIANA, 141004, PUNJAB (INDIA)
 
Genome Editing Comes Of Age
Genome Editing Comes Of AgeGenome Editing Comes Of Age
Genome Editing Comes Of Age
Chris Thorne
 
Genome Editing Comes of Age; CRISPR, rAAV and the new landscape of molecular ...
Genome Editing Comes of Age; CRISPR, rAAV and the new landscape of molecular ...Genome Editing Comes of Age; CRISPR, rAAV and the new landscape of molecular ...
Genome Editing Comes of Age; CRISPR, rAAV and the new landscape of molecular ...
Candy Smellie
 
Genome editing comes of age
Genome editing comes of ageGenome editing comes of age
Genome editing comes of age
Jan Hryca
 
nonsyndromic orofacial cleft and palate
nonsyndromic orofacial cleft and palatenonsyndromic orofacial cleft and palate
nonsyndromic orofacial cleft and palate
had89
 
Mdadar 3
Mdadar   3Mdadar   3
Mdadar 3
Maryam Dadar
 
Crop plants: DNA-free genome editing with CRISPR enzymes
Crop plants: DNA-free genome editing with CRISPR enzymesCrop plants: DNA-free genome editing with CRISPR enzymes
Crop plants: DNA-free genome editing with CRISPR enzymes
OECD Environment
 
Peter Morrell Ag Experimental Station Talk 2018
Peter Morrell Ag Experimental Station Talk 2018Peter Morrell Ag Experimental Station Talk 2018
Peter Morrell Ag Experimental Station Talk 2018
PeterMorrell4
 
Making genome edits in mammalian cells
Making genome edits in mammalian cellsMaking genome edits in mammalian cells
Making genome edits in mammalian cells
Chris Thorne
 
CRISPR Is On The Move: Genome Editing From Rice To Wheat
CRISPR Is On The Move: Genome Editing From Rice To WheatCRISPR Is On The Move: Genome Editing From Rice To Wheat
CRISPR Is On The Move: Genome Editing From Rice To Wheat
Fabio Caligaris
 
2.2 analyzing and manipulating dna
2.2 analyzing and manipulating dna2.2 analyzing and manipulating dna
2.2 analyzing and manipulating dna
Emmanuel Aguon
 
Lessons learned from high throughput CRISPR targeting in human cell lines
Lessons learned from high throughput CRISPR targeting in human cell linesLessons learned from high throughput CRISPR targeting in human cell lines
Lessons learned from high throughput CRISPR targeting in human cell lines
Chris Thorne
 
Doubled Haploid Production Techniques of Horticultural Crops
Doubled Haploid  Production Techniques  of Horticultural CropsDoubled Haploid  Production Techniques  of Horticultural Crops
Doubled Haploid Production Techniques of Horticultural Crops
Mahbubul Hassan
 
HIV Vaccines Process Development & Manufacturing - Pitfalls & Possibilities
HIV Vaccines Process Development & Manufacturing - Pitfalls & PossibilitiesHIV Vaccines Process Development & Manufacturing - Pitfalls & Possibilities
HIV Vaccines Process Development & Manufacturing - Pitfalls & Possibilities
KBI Biopharma
 
CRISPR-Cas9 : A novel tool for genome editing for crop improvement
CRISPR-Cas9 : A novel tool for genome editing for crop improvementCRISPR-Cas9 : A novel tool for genome editing for crop improvement
CRISPR-Cas9 : A novel tool for genome editing for crop improvement
Garima188199
 
Population Calling: a powerful tool for novel mutation detection in larger sa...
Population Calling: a powerful tool for novel mutation detection in larger sa...Population Calling: a powerful tool for novel mutation detection in larger sa...
Population Calling: a powerful tool for novel mutation detection in larger sa...
GENALICE
 
A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...
A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...
A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...
Merck Life Sciences
 
A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...
A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...
A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...
MilliporeSigma
 
" Harnessing agricultural biotechnology for resilience to climate change: A l...
" Harnessing agricultural biotechnology for resilience to climate change: A l..." Harnessing agricultural biotechnology for resilience to climate change: A l...
" Harnessing agricultural biotechnology for resilience to climate change: A l...
ExternalEvents
 
Advances in gene-based crop modeling
Advances in gene-based crop modelingAdvances in gene-based crop modeling
Advances in gene-based crop modeling
CIAT
 

Similar to Targeted Breeding Applications of CRISPR-Cas (20)

CRISPR mediated haploid inducer stock development in rice
CRISPR mediated haploid inducer stock development in riceCRISPR mediated haploid inducer stock development in rice
CRISPR mediated haploid inducer stock development in rice
 
Genome Editing Comes Of Age
Genome Editing Comes Of AgeGenome Editing Comes Of Age
Genome Editing Comes Of Age
 
Genome Editing Comes of Age; CRISPR, rAAV and the new landscape of molecular ...
Genome Editing Comes of Age; CRISPR, rAAV and the new landscape of molecular ...Genome Editing Comes of Age; CRISPR, rAAV and the new landscape of molecular ...
Genome Editing Comes of Age; CRISPR, rAAV and the new landscape of molecular ...
 
Genome editing comes of age
Genome editing comes of ageGenome editing comes of age
Genome editing comes of age
 
nonsyndromic orofacial cleft and palate
nonsyndromic orofacial cleft and palatenonsyndromic orofacial cleft and palate
nonsyndromic orofacial cleft and palate
 
Mdadar 3
Mdadar   3Mdadar   3
Mdadar 3
 
Crop plants: DNA-free genome editing with CRISPR enzymes
Crop plants: DNA-free genome editing with CRISPR enzymesCrop plants: DNA-free genome editing with CRISPR enzymes
Crop plants: DNA-free genome editing with CRISPR enzymes
 
Peter Morrell Ag Experimental Station Talk 2018
Peter Morrell Ag Experimental Station Talk 2018Peter Morrell Ag Experimental Station Talk 2018
Peter Morrell Ag Experimental Station Talk 2018
 
Making genome edits in mammalian cells
Making genome edits in mammalian cellsMaking genome edits in mammalian cells
Making genome edits in mammalian cells
 
CRISPR Is On The Move: Genome Editing From Rice To Wheat
CRISPR Is On The Move: Genome Editing From Rice To WheatCRISPR Is On The Move: Genome Editing From Rice To Wheat
CRISPR Is On The Move: Genome Editing From Rice To Wheat
 
2.2 analyzing and manipulating dna
2.2 analyzing and manipulating dna2.2 analyzing and manipulating dna
2.2 analyzing and manipulating dna
 
Lessons learned from high throughput CRISPR targeting in human cell lines
Lessons learned from high throughput CRISPR targeting in human cell linesLessons learned from high throughput CRISPR targeting in human cell lines
Lessons learned from high throughput CRISPR targeting in human cell lines
 
Doubled Haploid Production Techniques of Horticultural Crops
Doubled Haploid  Production Techniques  of Horticultural CropsDoubled Haploid  Production Techniques  of Horticultural Crops
Doubled Haploid Production Techniques of Horticultural Crops
 
HIV Vaccines Process Development & Manufacturing - Pitfalls & Possibilities
HIV Vaccines Process Development & Manufacturing - Pitfalls & PossibilitiesHIV Vaccines Process Development & Manufacturing - Pitfalls & Possibilities
HIV Vaccines Process Development & Manufacturing - Pitfalls & Possibilities
 
CRISPR-Cas9 : A novel tool for genome editing for crop improvement
CRISPR-Cas9 : A novel tool for genome editing for crop improvementCRISPR-Cas9 : A novel tool for genome editing for crop improvement
CRISPR-Cas9 : A novel tool for genome editing for crop improvement
 
Population Calling: a powerful tool for novel mutation detection in larger sa...
Population Calling: a powerful tool for novel mutation detection in larger sa...Population Calling: a powerful tool for novel mutation detection in larger sa...
Population Calling: a powerful tool for novel mutation detection in larger sa...
 
A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...
A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...
A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...
 
A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...
A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...
A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Proce...
 
" Harnessing agricultural biotechnology for resilience to climate change: A l...
" Harnessing agricultural biotechnology for resilience to climate change: A l..." Harnessing agricultural biotechnology for resilience to climate change: A l...
" Harnessing agricultural biotechnology for resilience to climate change: A l...
 
Advances in gene-based crop modeling
Advances in gene-based crop modelingAdvances in gene-based crop modeling
Advances in gene-based crop modeling
 

More from Kate Barlow

CoMEHeRe: Co-operative Models for Evidence-based Healthcare Redistribution
CoMEHeRe: Co-operative Models for Evidence-based Healthcare RedistributionCoMEHeRe: Co-operative Models for Evidence-based Healthcare Redistribution
CoMEHeRe: Co-operative Models for Evidence-based Healthcare Redistribution
Kate Barlow
 
Evaluating How Blockchain Can Transform the Pharmaceutical and Healthcare Ind...
Evaluating How Blockchain Can Transform the Pharmaceutical and Healthcare Ind...Evaluating How Blockchain Can Transform the Pharmaceutical and Healthcare Ind...
Evaluating How Blockchain Can Transform the Pharmaceutical and Healthcare Ind...
Kate Barlow
 
NIZO: Hotspot for Microbiome Research
NIZO: Hotspot for Microbiome ResearchNIZO: Hotspot for Microbiome Research
NIZO: Hotspot for Microbiome Research
Kate Barlow
 
Precision in Plant Immune Expression: Not Lost in Translation
Precision in Plant Immune Expression: Not Lost in Translation Precision in Plant Immune Expression: Not Lost in Translation
Precision in Plant Immune Expression: Not Lost in Translation
Kate Barlow
 
Beyond GWAS QTL Identification and Strategies to Increase Yield
Beyond GWAS QTL Identification and Strategies to Increase YieldBeyond GWAS QTL Identification and Strategies to Increase Yield
Beyond GWAS QTL Identification and Strategies to Increase Yield
Kate Barlow
 
Information Technology Meets Synthetic Biology for Ag-Tech
Information Technology Meets Synthetic Biology for Ag-Tech Information Technology Meets Synthetic Biology for Ag-Tech
Information Technology Meets Synthetic Biology for Ag-Tech
Kate Barlow
 
From Simple to Complex – Phytobiomes and the 2050 Vision for Agriculture
From Simple to Complex – Phytobiomes and the 2050 Vision for AgricultureFrom Simple to Complex – Phytobiomes and the 2050 Vision for Agriculture
From Simple to Complex – Phytobiomes and the 2050 Vision for Agriculture
Kate Barlow
 
A Universal Genetic Switch for Increasing Plant Yields, Stress Tolerance and ...
A Universal Genetic Switch for Increasing Plant Yields, Stress Tolerance and ...A Universal Genetic Switch for Increasing Plant Yields, Stress Tolerance and ...
A Universal Genetic Switch for Increasing Plant Yields, Stress Tolerance and ...
Kate Barlow
 
Informatics in Context: Managing Sample-to-Answer Multi-Omics Workflows
Informatics in Context: Managing Sample-to-Answer Multi-Omics WorkflowsInformatics in Context: Managing Sample-to-Answer Multi-Omics Workflows
Informatics in Context: Managing Sample-to-Answer Multi-Omics Workflows
Kate Barlow
 
Prospects for Digital PCR in Absolute Quantification of DNA and RNA
Prospects for Digital PCR in Absolute Quantification of DNA and RNAProspects for Digital PCR in Absolute Quantification of DNA and RNA
Prospects for Digital PCR in Absolute Quantification of DNA and RNA
Kate Barlow
 
Challenges and Opportunities for Digital PCR in the CLIA Laboratory of the Mo...
Challenges and Opportunities for Digital PCR in the CLIA Laboratory of the Mo...Challenges and Opportunities for Digital PCR in the CLIA Laboratory of the Mo...
Challenges and Opportunities for Digital PCR in the CLIA Laboratory of the Mo...
Kate Barlow
 
Circulating Tumor DNA Detection from Heparinized Plasma Samples by Droplet Di...
Circulating Tumor DNA Detection from Heparinized Plasma Samples by Droplet Di...Circulating Tumor DNA Detection from Heparinized Plasma Samples by Droplet Di...
Circulating Tumor DNA Detection from Heparinized Plasma Samples by Droplet Di...
Kate Barlow
 
Two-Tailed PCR - New Ultrasensitive and Ultraspecific Technique for the Quant...
Two-Tailed PCR - New Ultrasensitive and Ultraspecific Technique for the Quant...Two-Tailed PCR - New Ultrasensitive and Ultraspecific Technique for the Quant...
Two-Tailed PCR - New Ultrasensitive and Ultraspecific Technique for the Quant...
Kate Barlow
 
Admix™: Custom lyophilised RT-PCR reagents for point-of-use applications
Admix™: Custom lyophilised RT-PCR reagents for point-of-use applicationsAdmix™: Custom lyophilised RT-PCR reagents for point-of-use applications
Admix™: Custom lyophilised RT-PCR reagents for point-of-use applications
Kate Barlow
 
Explaining Biocide Tolerance of Gram Negative Bacteria
Explaining Biocide Tolerance of Gram Negative Bacteria Explaining Biocide Tolerance of Gram Negative Bacteria
Explaining Biocide Tolerance of Gram Negative Bacteria
Kate Barlow
 
Optimized Design of Broadly Detecting qPCR Primers and Probes Using a Conserv...
Optimized Design of Broadly Detecting qPCR Primers and Probes Using a Conserv...Optimized Design of Broadly Detecting qPCR Primers and Probes Using a Conserv...
Optimized Design of Broadly Detecting qPCR Primers and Probes Using a Conserv...
Kate Barlow
 
MelTree: A Novel Workflow for the Automated Identification of a Large Number ...
MelTree: A Novel Workflow for the Automated Identification of a Large Number ...MelTree: A Novel Workflow for the Automated Identification of a Large Number ...
MelTree: A Novel Workflow for the Automated Identification of a Large Number ...
Kate Barlow
 
Discordance Between Replicate qPCR Reactions
Discordance Between Replicate qPCR ReactionsDiscordance Between Replicate qPCR Reactions
Discordance Between Replicate qPCR Reactions
Kate Barlow
 
Development and Clinical Validation of Liquid ddPCR Tests for Actionable Soma...
Development and Clinical Validation of Liquid ddPCR Tests for Actionable Soma...Development and Clinical Validation of Liquid ddPCR Tests for Actionable Soma...
Development and Clinical Validation of Liquid ddPCR Tests for Actionable Soma...
Kate Barlow
 
Clinical Utility of Droplet Digital PCR on Liquid Biopsies from Patients with...
Clinical Utility of Droplet Digital PCR on Liquid Biopsies from Patients with...Clinical Utility of Droplet Digital PCR on Liquid Biopsies from Patients with...
Clinical Utility of Droplet Digital PCR on Liquid Biopsies from Patients with...
Kate Barlow
 

More from Kate Barlow (20)

CoMEHeRe: Co-operative Models for Evidence-based Healthcare Redistribution
CoMEHeRe: Co-operative Models for Evidence-based Healthcare RedistributionCoMEHeRe: Co-operative Models for Evidence-based Healthcare Redistribution
CoMEHeRe: Co-operative Models for Evidence-based Healthcare Redistribution
 
Evaluating How Blockchain Can Transform the Pharmaceutical and Healthcare Ind...
Evaluating How Blockchain Can Transform the Pharmaceutical and Healthcare Ind...Evaluating How Blockchain Can Transform the Pharmaceutical and Healthcare Ind...
Evaluating How Blockchain Can Transform the Pharmaceutical and Healthcare Ind...
 
NIZO: Hotspot for Microbiome Research
NIZO: Hotspot for Microbiome ResearchNIZO: Hotspot for Microbiome Research
NIZO: Hotspot for Microbiome Research
 
Precision in Plant Immune Expression: Not Lost in Translation
Precision in Plant Immune Expression: Not Lost in Translation Precision in Plant Immune Expression: Not Lost in Translation
Precision in Plant Immune Expression: Not Lost in Translation
 
Beyond GWAS QTL Identification and Strategies to Increase Yield
Beyond GWAS QTL Identification and Strategies to Increase YieldBeyond GWAS QTL Identification and Strategies to Increase Yield
Beyond GWAS QTL Identification and Strategies to Increase Yield
 
Information Technology Meets Synthetic Biology for Ag-Tech
Information Technology Meets Synthetic Biology for Ag-Tech Information Technology Meets Synthetic Biology for Ag-Tech
Information Technology Meets Synthetic Biology for Ag-Tech
 
From Simple to Complex – Phytobiomes and the 2050 Vision for Agriculture
From Simple to Complex – Phytobiomes and the 2050 Vision for AgricultureFrom Simple to Complex – Phytobiomes and the 2050 Vision for Agriculture
From Simple to Complex – Phytobiomes and the 2050 Vision for Agriculture
 
A Universal Genetic Switch for Increasing Plant Yields, Stress Tolerance and ...
A Universal Genetic Switch for Increasing Plant Yields, Stress Tolerance and ...A Universal Genetic Switch for Increasing Plant Yields, Stress Tolerance and ...
A Universal Genetic Switch for Increasing Plant Yields, Stress Tolerance and ...
 
Informatics in Context: Managing Sample-to-Answer Multi-Omics Workflows
Informatics in Context: Managing Sample-to-Answer Multi-Omics WorkflowsInformatics in Context: Managing Sample-to-Answer Multi-Omics Workflows
Informatics in Context: Managing Sample-to-Answer Multi-Omics Workflows
 
Prospects for Digital PCR in Absolute Quantification of DNA and RNA
Prospects for Digital PCR in Absolute Quantification of DNA and RNAProspects for Digital PCR in Absolute Quantification of DNA and RNA
Prospects for Digital PCR in Absolute Quantification of DNA and RNA
 
Challenges and Opportunities for Digital PCR in the CLIA Laboratory of the Mo...
Challenges and Opportunities for Digital PCR in the CLIA Laboratory of the Mo...Challenges and Opportunities for Digital PCR in the CLIA Laboratory of the Mo...
Challenges and Opportunities for Digital PCR in the CLIA Laboratory of the Mo...
 
Circulating Tumor DNA Detection from Heparinized Plasma Samples by Droplet Di...
Circulating Tumor DNA Detection from Heparinized Plasma Samples by Droplet Di...Circulating Tumor DNA Detection from Heparinized Plasma Samples by Droplet Di...
Circulating Tumor DNA Detection from Heparinized Plasma Samples by Droplet Di...
 
Two-Tailed PCR - New Ultrasensitive and Ultraspecific Technique for the Quant...
Two-Tailed PCR - New Ultrasensitive and Ultraspecific Technique for the Quant...Two-Tailed PCR - New Ultrasensitive and Ultraspecific Technique for the Quant...
Two-Tailed PCR - New Ultrasensitive and Ultraspecific Technique for the Quant...
 
Admix™: Custom lyophilised RT-PCR reagents for point-of-use applications
Admix™: Custom lyophilised RT-PCR reagents for point-of-use applicationsAdmix™: Custom lyophilised RT-PCR reagents for point-of-use applications
Admix™: Custom lyophilised RT-PCR reagents for point-of-use applications
 
Explaining Biocide Tolerance of Gram Negative Bacteria
Explaining Biocide Tolerance of Gram Negative Bacteria Explaining Biocide Tolerance of Gram Negative Bacteria
Explaining Biocide Tolerance of Gram Negative Bacteria
 
Optimized Design of Broadly Detecting qPCR Primers and Probes Using a Conserv...
Optimized Design of Broadly Detecting qPCR Primers and Probes Using a Conserv...Optimized Design of Broadly Detecting qPCR Primers and Probes Using a Conserv...
Optimized Design of Broadly Detecting qPCR Primers and Probes Using a Conserv...
 
MelTree: A Novel Workflow for the Automated Identification of a Large Number ...
MelTree: A Novel Workflow for the Automated Identification of a Large Number ...MelTree: A Novel Workflow for the Automated Identification of a Large Number ...
MelTree: A Novel Workflow for the Automated Identification of a Large Number ...
 
Discordance Between Replicate qPCR Reactions
Discordance Between Replicate qPCR ReactionsDiscordance Between Replicate qPCR Reactions
Discordance Between Replicate qPCR Reactions
 
Development and Clinical Validation of Liquid ddPCR Tests for Actionable Soma...
Development and Clinical Validation of Liquid ddPCR Tests for Actionable Soma...Development and Clinical Validation of Liquid ddPCR Tests for Actionable Soma...
Development and Clinical Validation of Liquid ddPCR Tests for Actionable Soma...
 
Clinical Utility of Droplet Digital PCR on Liquid Biopsies from Patients with...
Clinical Utility of Droplet Digital PCR on Liquid Biopsies from Patients with...Clinical Utility of Droplet Digital PCR on Liquid Biopsies from Patients with...
Clinical Utility of Droplet Digital PCR on Liquid Biopsies from Patients with...
 

Recently uploaded

Detecting visual-media-borne disinformation: a summary of latest advances at ...
Detecting visual-media-borne disinformation: a summary of latest advances at ...Detecting visual-media-borne disinformation: a summary of latest advances at ...
Detecting visual-media-borne disinformation: a summary of latest advances at ...
VasileiosMezaris
 
20240515_CEBaP Poster_SR eating_drinking.pdf
20240515_CEBaP Poster_SR eating_drinking.pdf20240515_CEBaP Poster_SR eating_drinking.pdf
20240515_CEBaP Poster_SR eating_drinking.pdf
Hans Van Remoortel
 
Cultivation of human viruses and its different techniques.
Cultivation of human viruses and its different techniques.Cultivation of human viruses and its different techniques.
Cultivation of human viruses and its different techniques.
MDAsifKilledar
 
WHO 6TH EDITION UPDATE FOR SEMEN ANALYSIS
WHO 6TH EDITION UPDATE FOR SEMEN ANALYSISWHO 6TH EDITION UPDATE FOR SEMEN ANALYSIS
WHO 6TH EDITION UPDATE FOR SEMEN ANALYSIS
SRI AUROBINDO UNIVERSITY
 
BIOLOGY ANIMAL KINGDOM CLASS. 11 NCERT..
BIOLOGY ANIMAL KINGDOM CLASS. 11 NCERT..BIOLOGY ANIMAL KINGDOM CLASS. 11 NCERT..
BIOLOGY ANIMAL KINGDOM CLASS. 11 NCERT..
suriyaj2310
 
GBSN - Microbiology (Unit 2) Susceptibility of Microbial agents
GBSN - Microbiology (Unit 2) Susceptibility of Microbial agentsGBSN - Microbiology (Unit 2) Susceptibility of Microbial agents
GBSN - Microbiology (Unit 2) Susceptibility of Microbial agents
Areesha Ahmad
 
22PH503 - Astronomy and Astrophysics - Unit 2 - Spectral Classification of Stars
22PH503 - Astronomy and Astrophysics - Unit 2 - Spectral Classification of Stars22PH503 - Astronomy and Astrophysics - Unit 2 - Spectral Classification of Stars
22PH503 - Astronomy and Astrophysics - Unit 2 - Spectral Classification of Stars
RDhivya6
 
Discovery of Merging Twin Quasars at z=6.05
Discovery of Merging Twin Quasars at z=6.05Discovery of Merging Twin Quasars at z=6.05
Discovery of Merging Twin Quasars at z=6.05
Sérgio Sacani
 
Compositions of iron-meteorite parent bodies constrainthe structure of the pr...
Compositions of iron-meteorite parent bodies constrainthe structure of the pr...Compositions of iron-meteorite parent bodies constrainthe structure of the pr...
Compositions of iron-meteorite parent bodies constrainthe structure of the pr...
Sérgio Sacani
 
Premuim Call Girls Pune 🔥 7014168258 🔥 Real Fun With Sexual Girl Available 24...
Premuim Call Girls Pune 🔥 7014168258 🔥 Real Fun With Sexual Girl Available 24...Premuim Call Girls Pune 🔥 7014168258 🔥 Real Fun With Sexual Girl Available 24...
Premuim Call Girls Pune 🔥 7014168258 🔥 Real Fun With Sexual Girl Available 24...
$A19
 
一比一原版美国佩斯大学毕业证如何办理
一比一原版美国佩斯大学毕业证如何办理一比一原版美国佩斯大学毕业证如何办理
一比一原版美国佩斯大学毕业证如何办理
gyhwyo
 
Signatures of wave erosion in Titan’s coasts
Signatures of wave erosion in Titan’s coastsSignatures of wave erosion in Titan’s coasts
Signatures of wave erosion in Titan’s coasts
Sérgio Sacani
 
ball mill bearing slide shoe bearing trunion bearing metal
ball mill bearing slide shoe bearing  trunion bearing metalball mill bearing slide shoe bearing  trunion bearing metal
ball mill bearing slide shoe bearing trunion bearing metal
srinivasaraonerella1
 
Mapping the Growth of Supermassive Black Holes as a Function of Galaxy Stella...
Mapping the Growth of Supermassive Black Holes as a Function of Galaxy Stella...Mapping the Growth of Supermassive Black Holes as a Function of Galaxy Stella...
Mapping the Growth of Supermassive Black Holes as a Function of Galaxy Stella...
Sérgio Sacani
 
20240610_INSIGHT_PartnerProfile-02_Tampere.pdf
20240610_INSIGHT_PartnerProfile-02_Tampere.pdf20240610_INSIGHT_PartnerProfile-02_Tampere.pdf
20240610_INSIGHT_PartnerProfile-02_Tampere.pdf
Steffi Friedrichs
 
SAP Unveils Generative AI Innovations at Annual Sapphire Conference
SAP Unveils Generative AI Innovations at Annual Sapphire ConferenceSAP Unveils Generative AI Innovations at Annual Sapphire Conference
SAP Unveils Generative AI Innovations at Annual Sapphire Conference
CGB SOLUTIONS
 
Analysis of Polygenic Traits (GPB-602)
Analysis of Polygenic Traits (GPB-602)Analysis of Polygenic Traits (GPB-602)
Analysis of Polygenic Traits (GPB-602)
PABOLU TEJASREE
 
Embracing Deep Variability For Reproducibility and Replicability
Embracing Deep Variability For Reproducibility and ReplicabilityEmbracing Deep Variability For Reproducibility and Replicability
Embracing Deep Variability For Reproducibility and Replicability
University of Rennes, INSA Rennes, Inria/IRISA, CNRS
 
(Shilpa) ➤ Call Girls Lucknow 🔥 9352988975 🔥 Real Fun With Sexual Girl Availa...
(Shilpa) ➤ Call Girls Lucknow 🔥 9352988975 🔥 Real Fun With Sexual Girl Availa...(Shilpa) ➤ Call Girls Lucknow 🔥 9352988975 🔥 Real Fun With Sexual Girl Availa...
(Shilpa) ➤ Call Girls Lucknow 🔥 9352988975 🔥 Real Fun With Sexual Girl Availa...
shourabjaat424
 
Firoozeh Kashani-Sabet - An Esteemed Professor
Firoozeh Kashani-Sabet - An Esteemed ProfessorFiroozeh Kashani-Sabet - An Esteemed Professor
Firoozeh Kashani-Sabet - An Esteemed Professor
Firoozeh Kashani-Sabet
 

Recently uploaded (20)

Detecting visual-media-borne disinformation: a summary of latest advances at ...
Detecting visual-media-borne disinformation: a summary of latest advances at ...Detecting visual-media-borne disinformation: a summary of latest advances at ...
Detecting visual-media-borne disinformation: a summary of latest advances at ...
 
20240515_CEBaP Poster_SR eating_drinking.pdf
20240515_CEBaP Poster_SR eating_drinking.pdf20240515_CEBaP Poster_SR eating_drinking.pdf
20240515_CEBaP Poster_SR eating_drinking.pdf
 
Cultivation of human viruses and its different techniques.
Cultivation of human viruses and its different techniques.Cultivation of human viruses and its different techniques.
Cultivation of human viruses and its different techniques.
 
WHO 6TH EDITION UPDATE FOR SEMEN ANALYSIS
WHO 6TH EDITION UPDATE FOR SEMEN ANALYSISWHO 6TH EDITION UPDATE FOR SEMEN ANALYSIS
WHO 6TH EDITION UPDATE FOR SEMEN ANALYSIS
 
BIOLOGY ANIMAL KINGDOM CLASS. 11 NCERT..
BIOLOGY ANIMAL KINGDOM CLASS. 11 NCERT..BIOLOGY ANIMAL KINGDOM CLASS. 11 NCERT..
BIOLOGY ANIMAL KINGDOM CLASS. 11 NCERT..
 
GBSN - Microbiology (Unit 2) Susceptibility of Microbial agents
GBSN - Microbiology (Unit 2) Susceptibility of Microbial agentsGBSN - Microbiology (Unit 2) Susceptibility of Microbial agents
GBSN - Microbiology (Unit 2) Susceptibility of Microbial agents
 
22PH503 - Astronomy and Astrophysics - Unit 2 - Spectral Classification of Stars
22PH503 - Astronomy and Astrophysics - Unit 2 - Spectral Classification of Stars22PH503 - Astronomy and Astrophysics - Unit 2 - Spectral Classification of Stars
22PH503 - Astronomy and Astrophysics - Unit 2 - Spectral Classification of Stars
 
Discovery of Merging Twin Quasars at z=6.05
Discovery of Merging Twin Quasars at z=6.05Discovery of Merging Twin Quasars at z=6.05
Discovery of Merging Twin Quasars at z=6.05
 
Compositions of iron-meteorite parent bodies constrainthe structure of the pr...
Compositions of iron-meteorite parent bodies constrainthe structure of the pr...Compositions of iron-meteorite parent bodies constrainthe structure of the pr...
Compositions of iron-meteorite parent bodies constrainthe structure of the pr...
 
Premuim Call Girls Pune 🔥 7014168258 🔥 Real Fun With Sexual Girl Available 24...
Premuim Call Girls Pune 🔥 7014168258 🔥 Real Fun With Sexual Girl Available 24...Premuim Call Girls Pune 🔥 7014168258 🔥 Real Fun With Sexual Girl Available 24...
Premuim Call Girls Pune 🔥 7014168258 🔥 Real Fun With Sexual Girl Available 24...
 
一比一原版美国佩斯大学毕业证如何办理
一比一原版美国佩斯大学毕业证如何办理一比一原版美国佩斯大学毕业证如何办理
一比一原版美国佩斯大学毕业证如何办理
 
Signatures of wave erosion in Titan’s coasts
Signatures of wave erosion in Titan’s coastsSignatures of wave erosion in Titan’s coasts
Signatures of wave erosion in Titan’s coasts
 
ball mill bearing slide shoe bearing trunion bearing metal
ball mill bearing slide shoe bearing  trunion bearing metalball mill bearing slide shoe bearing  trunion bearing metal
ball mill bearing slide shoe bearing trunion bearing metal
 
Mapping the Growth of Supermassive Black Holes as a Function of Galaxy Stella...
Mapping the Growth of Supermassive Black Holes as a Function of Galaxy Stella...Mapping the Growth of Supermassive Black Holes as a Function of Galaxy Stella...
Mapping the Growth of Supermassive Black Holes as a Function of Galaxy Stella...
 
20240610_INSIGHT_PartnerProfile-02_Tampere.pdf
20240610_INSIGHT_PartnerProfile-02_Tampere.pdf20240610_INSIGHT_PartnerProfile-02_Tampere.pdf
20240610_INSIGHT_PartnerProfile-02_Tampere.pdf
 
SAP Unveils Generative AI Innovations at Annual Sapphire Conference
SAP Unveils Generative AI Innovations at Annual Sapphire ConferenceSAP Unveils Generative AI Innovations at Annual Sapphire Conference
SAP Unveils Generative AI Innovations at Annual Sapphire Conference
 
Analysis of Polygenic Traits (GPB-602)
Analysis of Polygenic Traits (GPB-602)Analysis of Polygenic Traits (GPB-602)
Analysis of Polygenic Traits (GPB-602)
 
Embracing Deep Variability For Reproducibility and Replicability
Embracing Deep Variability For Reproducibility and ReplicabilityEmbracing Deep Variability For Reproducibility and Replicability
Embracing Deep Variability For Reproducibility and Replicability
 
(Shilpa) ➤ Call Girls Lucknow 🔥 9352988975 🔥 Real Fun With Sexual Girl Availa...
(Shilpa) ➤ Call Girls Lucknow 🔥 9352988975 🔥 Real Fun With Sexual Girl Availa...(Shilpa) ➤ Call Girls Lucknow 🔥 9352988975 🔥 Real Fun With Sexual Girl Availa...
(Shilpa) ➤ Call Girls Lucknow 🔥 9352988975 🔥 Real Fun With Sexual Girl Availa...
 
Firoozeh Kashani-Sabet - An Esteemed Professor
Firoozeh Kashani-Sabet - An Esteemed ProfessorFiroozeh Kashani-Sabet - An Esteemed Professor
Firoozeh Kashani-Sabet - An Esteemed Professor
 

Targeted Breeding Applications of CRISPR-Cas

  • 1. Targeted Breeding Applications of CRISPR-Cas Doane Chilcoat, DuPont Pioneer, Dow DuPont
  • 2. • Why we are excited about genome editing • Genome editing technology • Examples
  • 3. Six vegetables that are the same biological species Kohlrabi Kale Broccoli Brussels Sprouts Cabbage Cauliflower Wild mustard Genome editing replicates naturally occurring outcomes
  • 4. Duplication of SUN gene changes fruit morphology Genome editing replicates naturally occurring outcomes
  • 5. Between two corn varieties • 100s of genes with different numbers of copies • 1,000s of genes absent in one but present in the other Genome editing replicates naturally occurring outcomes
  • 6. Genome editing replicates naturally occurring outcomes • 7 single nucleotide mutations per billion base pairs per generation • 1 hectare of soy has >1.8 million novel mutations
  • 7. Year: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Editing Edited variety development can be rapid Breeding Transgenes 1st commercial sales in year 13-20 1st commercial sales in year 4 1st commercial sales in year 9
  • 8. Many potential applications for genome editing
  • 9. • Why we are excited about genome editing • Genome editing technology • Examples
  • 10. Elite line plant regeneration Reference genomics Double strand break reagents Technology foundation for plant genome editing
  • 11. Plant Cell (2005) Example of maize diversity Mo17-specific: 30kb Shared sequence: A B C D E B73-specific: F G H I
  • 12. New technologies enable reference genomes Sequel ContigsLong reads Saphyr ScaffoldsOptical mapping Chromium PolishingRead clouds Chromosomes HiC Technology Application Outcome Genome contiguity
  • 13. Pioneer Maize2: a new benchmark for maize reference genomes 17 11 16 11 9 7 5 7 10 1 197 De novo elite maize reference genome • Contig N50 2.8 Mb • Scaffold N50 36.9 Mb Chr01 Chr02 Chr03 Chr04 Chr05 Chr06 Chr07 Chr08 Chr09 Chr10 Unmapped
  • 14. Elite line plant regeneration 18.7 15.4 9 29 45.5 34.2 20 0.6 4.8 6 2.6 PH2HT PHH5G PH43V PH85E PHAF7 PHCD9 PH4M3 PH84Z PHCMS PH26C PH8SY Regeneration frequency Percent 50.0 After optimization
  • 15. Vectors containing Babyboom and Wuschel trigger rapid somatic embryogenesis Embryos at 7 days Well formed somatic embryos visible at 2- 4 days High mitotic index in young embryos 15
  • 16. Site-Seq can identify off-sites High molecular weight genomic DNA Digest with Cas9 RNP “A” addition Ligate biotinylated adapter Random shear / size select “ A” addition, ligation to adapters Biotin selection PCR Sequencing
  • 17. 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 PAM G G C C G A G G T C G A C T A C C G G C CGG M2 MS45-CR2 C G C C G A G G G C G A C T A C C G G C AGG Off-Site 1 G G T G G G G G T C G A C T A C C G G C AGG Off-Site 2 C G A C T A G A T C G A C T A C C G G C GGG Off-Site 3 C G C C G C G G G C G A C T A C C G G C AGG Off-Site 4 G G G A C G A G G C G A T T A C C G G C GGG Off-Site 5 A G A C G A T G T C G A C C G C C G C GGG Off-Site 6 G C C C C A T G T C G A C T A C C G G C AGG Off-Site 7 A T G G C T A G G A G A C T A C C G G C TGG Off-Site 8 Red = Mismatch; Black = Gap Site-Seq can identify off-sites
  • 18. 1. Select unique sites informatically Achieving specificity through guide design and testing 1 Mismatch 2 Mismatch 3 Mismatch 4 Mismatch Site 1 0 0 0 0 Site 2 0 0 0 0 Site 3 0 0 0 23 Site 4 0 0 8 34 Site 5 0 0 10 41 Site 6 0 0 54 261 Site 7 0 1 51 236 Site 8 0 2 151 116 Site 9 0 3 48 126 Site 10 0 7 117 396 Site 11 0 9 96 528 Site 12 0 10 317 2209 Site 13 0 32 674 1142 Site 14 1 19 764 2713 Site 15 3 41 433 635 Number of Predicted Off-Sites Effect of RNP Concentration on On- and Off-Site Cleavage 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 PAM 10 nM 100 nM 1000 nM On-Site G G C C G A G G T C G A C T A C C G G C CGG Y Y Y Off-Site 1 C G C C G A G G G C G A C T A C C G G C AGG Y Y Y Off-Site 2 G G T G G G G G T C G A C T A C C G G C AGG Y Y Y Off-Site 3 C G A C T A G A T C G A C T A C C G G C GGG N Y Y Off-Site 4 C G C C G C G G G C G A C T A C C G G C AGG N Y Y Off-Site 5 G G G A C G A G G C G A T T A C C G G C GGG N N Y Protospacer RNP Concentration 2. Confirm target specificity in vitro (SITE-Seq+)
  • 19. On/off-target sequencing Select off-target free plant Backcross to remove potential off-site mutation T0 WT 50% T0 50% WT WT X Ensuring edited plants match recurrent parents 25% T0 75% WT
  • 20. Double strand break reagents Streptococcus pyogenes Cas9 Guide RNA matches the target DNA sequence Cas9 nuclease (DNA cutting enzyme) Target Sequence Guide RNA
  • 21. • Why we are excited about genome editing • Genome editing technology • Examples
  • 22. How can we use CRISPR-Cas? WHEAT Seed No Seed Delete Edit Move
  • 23. CRISPR-Cas: DuPont Pioneer work across crops Today’s presentation * Disease Yield Drought Output Maturity Corn Soy Canola Rice Wheat Sunflower ** *
  • 24. Example #1: Waxy corn Waxy Corn • Non-functional wx1 • Candlewax-like appearance • Food / industrial >97% Amylopectin Starch • Functional wx1 • Translucent appearance • Feed / ethanol / food No. 2 Yellow Dent Corn 75% Amylopectin 25% Amylose Starch Pioneer’s first commercial product through targeted breeding
  • 25. Status • Edits made in multiple inbreds – can be combined to make 10 elite hybrids • Contain expected edit; no other DNA • Expected waxy seed composition Wild-type Wx1 Transcriptional start Guide 1 Guide 2 4kb deletion Edited Wx1 Iodine stain of segregating seeds Waxy kernel Stains lighter Waxy corn gene editing approach: gene deletion
  • 26. Regulatory/ Acceptance CRISPR waxy large scale field trials summer 2017 • USDA: not regulated by its Biotechnology Regulatory Service • CONABIA: not a “GMO” under Argentina law • Other import markets: discussions underway Wild type Conventional waxy CRISPR waxy
  • 27. Example #2: corn northern leaf blight (NLB) Fungal disease caused by Exserohilum turcicum Grain yield loss can be 18% - 98%
  • 28. Resistance to northern leaf blight • NLB18 gene cloned and encodes a receptor-like kinase • Transgenic maize plants overexpressing NLB18 with heterologous promoter are resistant to NLB NLB18 overexpression Wild type
  • 29. Inserted the resistant NLB18 gene at a breeding stack locus NLB gene editing approach (a): gene insertion Hemizygous Null Homozygous 1.0 1.8 NLB 18 expression RT-PCR 2017 field testing 5.4 v v v Chr1 Resistant allele
  • 30. Mutants generated using EMS 2016 Example #3: Fea3
  • 31. Editing Fea3 to generate 3-2 allele C417Y GCGGCGGTTCGCGTCGTGGGACAACCCCGGGCTGTGCTACAACGTC CGCCGCCAAGCGCAGCACCCTGTTGGGGCCCGACACGATGTTGCAG GCGGCGGTTCGCGTCGTGGGACAACCCCGGTCTGTACTACAACGTC Cys Tyr PAM GCGGCGGTTCGCGTCGTGGGATAACCCAGGTCTGTACTACAACGTC Guide 1 Guide 2 Repair template: oligos with 3’ protected ends (phosphorothioate) Fea3-2
  • 32. Generated fea3-2 in elite inbreds Oligo template T0 plants Plants with desired edit dsOligo-1 144 6 dsOligo-2 162 16
  翻译: